ADN

Descripción del ADN

El ácido desoxirribonucleico, frecuentemente abreviado ADN (o en ingles DNA, Deoxyribonucleic Acid), constituye el principal componente del material genético de la inmensa mayoría de los organismos, junto con el ARN, siendo el componente químico primario de los cromosomas y el material en el que los genes están codificados.

En las bacterias, el ADN se encuentra en el citoplasma mientras que en organismos más complejos, tales como plantas, animales y otros organismos multicelulares, la mayoría del ADN reside en el núcleo celular. Se conoce desde hace más de cien años. El ADN fue identificado inicialmente en 1868 por Friendrich Miescher, biólogo suizo, en los núcleos de las células del pus obtenidas de los vendajes quirúrgicos desechados y en el esperma del salmón. Él llamó a la sustancia nucleína, aunque no fue reconocida hasta 1943 gracias al experimento realizado por Oswald Avery.

Su función principal es codificar las instrucciones esenciales para fabricar un ser vivo idéntico a aquel del que proviene (o casi similar, en el caso de mezclarse con otra cadena como es el caso de la reproducción sexual o de sufrir mutaciones).

El ADN es una molécula química de gran complejidad estructural, conocida desde hace mas de 100 años, como se mencionó anteriormente, pero no fue hasta 1953 que se hizo masivamente conocida gracias a los trabajos de los científicos James D. Watson y Francis H.C. Crick. Se encuentra repartido en los cromosomas, cuya función esencial es la de conservar la información durante la división celular, transmitirla de generación en generación y hacer efectiva la información genética que contienen. El número de cromosomas varía de una especie a otra; los humanos tenemos 23 pares, de los cuales la mitad procede del padre y la otra mitad de la madre.

A pesar de la complejidad del ADN, es necesario exponer algunos puntos esenciales para comprender su función y lo que actualmente están llevando a cabo los investigadores del genoma humano. El ADN es una larga sucesión de cuatro compuestos químicos básicos, llamados nucleótidos, que se conocen por las iniciales de sus bases: Adenina (A), Timina (T), Citosina (C), Guanina (G). La estructura espacial que adopta el ADN es la de una doble hélice o, si se prefiere, la de una escalera de caracol en la que los escalones están formados por estas bases.

El Código Genético

La sucesión de estas cuatro letras en el ADN constituye el peculiar lenguaje de esta molécula, que forma frases del tipo: GGCTATTAAACGATCGGGTC…; el texto íntegro del ADN de una célula humana está formado por una larga cadena, compuesta por unos 3.200 millones de letras.

La combinación de estas cuatro letras en frases, con un determinado significado funcional, es lo que se conoce como gen; se calcula que existen alrededor de 30.000 en el genoma humano. Estos genes regulan la expresión de todas las reacciones que se dan en nuestro cuerpo, a través de la fabricación de proteínas específicas; estas moléculas están compuestas de 20 aminoácidos, que corresponderían a las letras del idioma de las proteínas. Así, la información de nuestro material genético, el ADN, ha de ser traducido al lenguaje de las proteínas.

Esquema de Codificación

En 1961 Crick y sus colaboradores establecieron las características del código genético y, entre 1961 y 1964, los grupos dirigidos por Nirenberg, Ochoa y Khorona descifraron la clave del código genético. En el ADN, cada tres bases (lo que se conoce como triplete o codón) codifican, o indican en la traducción, un aminoácido distinto. Otras reglas de la lectura del ADN señalan que ésta no admite la superposición de tripletes y que existen 3 codones que sirven como señales de puntuación, indicando el comienzo y el final de la lectura. El proceso de lectura es complejo y se realiza en dos etapas, conocidas como transcripción y traducción; además, intervienen otras moléculas: ARN mensajero, ARN transferente y ribosomas, con cuya ayuda el ADN procesa la información necesaria para la construcción de las proteínas, las moléculas que mantienen todos los procesos biológicos del organismo.

Dentro de un gen existen secuencias inertes, que no codifican información alguna, conocidas como “intrones” o “ADN basura”; los fragmentos leídos, informativos o que codifican para la construcción de proteínas, se denominan “exones”. Por lo tanto, los genes se hallan distribuidos en la larga cadena del ADN en fragmentos, indistinguibles a simple vista del resto de la cadena. De este modo, podemos definir los genes como aquellas secciones de ADN que codifican la síntesis de una proteína


Cadena de ADN

Cadena de ADN

2 comentarios

  1. martina said,

    1 diciembre 2010 a 10:11 AM

    demas para estudiarrr.!los felicito mas bueno q nunca besos!

  2. DJUAN said,

    25 enero 2011 a 3:27 PM

    lo que sea lo qu es eso es bueno


Responder

Introduce tus datos o haz clic en un icono para iniciar sesión:

Logo de WordPress.com

Estás comentando usando tu cuenta de WordPress.com. Cerrar sesión / Cambiar )

Imagen de Twitter

Estás comentando usando tu cuenta de Twitter. Cerrar sesión / Cambiar )

Foto de Facebook

Estás comentando usando tu cuenta de Facebook. Cerrar sesión / Cambiar )

Google+ photo

Estás comentando usando tu cuenta de Google+. Cerrar sesión / Cambiar )

Conectando a %s

A %d blogueros les gusta esto: